Skip to content

shenwei356/LexicMap

Repository files navigation

LexicMap: efficient sequence alignment against millions of prokaryotic genomes​

Latest Version Anaconda Cloud Cross-platform license

LexicMap is a nucleotide sequence alignment tool for efficiently querying gene, plasmid, viral, or long-read sequences (>150 bp) against up to millions of prokaryotic genomes.

Documents: https://bioinf.shenwei.me/LexicMap

For the latest features and improvements, please download the pre-release binaries.

Preprint:

Wei Shen, John A. Lees, Zamin Iqbal. (2024) LexicMap: efficient sequence alignment against millions of prokaryotic genomes. bioRxiv. https://doi.org/10.1101/2024.08.30.610459

Table of contents

Features

  1. The accuracy of LexicMap is comparable with Blastn, MMseqs2, and Minimap2. It
    • performs base-level alignment, with qcovGnm, qcovHSP, pident, evalue and bitscore returned, both in TSV and pairwise alignment format (output format).
    • returns all possible matches, including multiple copies of a gene in a genome.
  2. The alignment is fast and memory-efficient, scalable to up to millions of prokaryotic genomes.
  3. LexicMap is easy to install, we provide binary files with no dependencies for Linux, Windows, MacOS (x86 and arm CPUs).
  4. LexicMap is easy to use (see tutorials, usages, and FAQs).
    • Database building requires only a simple command, accepting input from files, a file list, or even a directory.
    • Sequence searching supports limiting search by TaxId(s), provides a progress bar.
    • Several utility commands are available to resume unfinished indexing, and explore the index data, extract indexed subsequences.

Introduction

Motivation: Alignment against a database of genomes is a fundamental operation in bioinformatics, popularised by BLAST. However, given the increasing rate at which genomes are sequenced, existing tools struggle to scale.

  1. Existing full alignment tools face challenges of high memory consumption and slow speeds.
  2. Alignment-free large-scale sequence searching tools only return the matched genomes, without the vital positional information for downstream analysis.
  3. Mapping tools, or those utilizing compressed full-text indexes, return only the most similar matches.
  4. Prefilter+Align strategies have the sensitivity issue in the prefiltering step.

Methods: (algorithm overview)

  1. A rewritten and improved version of the sequence sketching method LexicHash is adopted to compute alignment seeds accurately and efficiently.
    • We solved the sketching deserts problem of LexicHash seeds to provide a window guarantee.
    • We added the support of suffix matching of seeds, making seeds much more tolerant to mutations. Any 31-bp seed with a common ≥15 bp prefix or suffix can be matched.
  2. A hierarchical index enables fast and low-memory variable-length seed matching (prefix + suffix matching).
  3. A pseudo alignment algorithm is used to find similar sequence regions from chaining results for alignment.
  4. A reimplemented Wavefront alignment algorithm is used for base-level alignment.

Results:

  1. LexicMap enables efficient indexing and searching of both RefSeq+GenBank and the AllTheBacteria datasets (2.3 and 1.9 million prokaryotic assemblies respectively).

  2. When searching in all 2,340,672 Genbank+Refseq prokaryotic genomes, Blastn is unable to run with this dataset on common servers as it requires >2000 GB RAM. (see performance).

    With LexicMap v0.7.0 (48 CPUs),

    Query Genome hits Genome hits
    (high-similarity)
    Genome hits
    (medium-similarity)
    Genome hits
    (low-similarity)
    Time RAM
    A 1.3-kb marker gene 41,718 11,746 115 29,857 3m:06s 3.97 GB
    A 1.5-kb 16S rRNA 1,955,167 245,884 501,691 1,207,592 32m:59s 11.09 GB
    A 52.8-kb plasmid 560,330 96 15,370 544,864 52m:22s 14.48 GB
    1003 AMR genes 30,967,882 7,636,386 4,858,063 18,473,433 15h:52m:08s 24.86 GB

    Notes:

    1. Default paramters are used, for returning all possible matches.
    2. Only the best alignment of a genome is used to evaluate alignment similarity:
      • high-similarity: (a) qcov >= 90% (genes) or 70% (plasmids), (b) pident>=90%.
      • medium-similarity: (a) not belong to high-similarity, (b) qcov >= 50% (genes) or 30% (plasmids), (c) pident>=80%.
      • low-similarity: left.
    3. The search time varies in different computing environments and mainly depends on the I/O speed.

More documents: https://bioinf.shenwei.me/LexicMap.

Quick start

Building an index (see the tutorial of building an index).

# From a directory with multiple genome files
lexicmap index -I genomes/ -O db.lmi

# From a file list with one file per line
lexicmap index -S -X files.txt -O db.lmi

Querying (see the tutorial of searching).

# For short queries like genes or long reads, returning top N hits.
lexicmap search -d db.lmi query.fasta -o query.fasta.lexicmap.tsv \
    --min-qcov-per-hsp 70 --min-qcov-per-genome 70  --top-n-genomes 10000

# For longer queries like plasmids, returning all hits.
lexicmap search -d db.lmi query.fasta -o query.fasta.lexicmap.tsv \
    --min-qcov-per-hsp 0  --min-qcov-per-genome 0   --top-n-genomes 0

Sample output (queries are a few Nanopore Q20 reads). See output format details.

query                qlen   hits   sgenome           sseqid              qcovGnm   cls   hsp   qcovHSP   alenHSP   pident   gaps   qstart   qend   sstart    send      sstr   slen      evalue      bitscore
------------------   ----   ----   ---------------   -----------------   -------   ---   ---   -------   -------   ------   ----   ------   ----   -------   -------   ----   -------   ---------   --------
ERR5396170.1000004   190    1      GCF_000227465.1   NC_016047.1         84.211    1     1     84.211    165       89.091   5      14       173    4189372   4189536   -      4207222   1.93e-63    253     
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    1     1     99.623    801       97.628   9      4        796    1138907   1139706   +      1887974   0.00e+00    1431    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    2     2     99.623    801       97.628   9      4        796    32607     33406     +      1887974   0.00e+00    1431    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    3     3     99.623    801       97.628   9      4        796    134468    135267    -      1887974   0.00e+00    1431    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    4     4     99.623    801       97.503   9      4        796    1768896   1769695   +      1887974   0.00e+00    1427    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    5     5     99.623    801       97.378   9      4        796    242012    242811    -      1887974   0.00e+00    1422    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    6     6     99.623    801       96.879   12     4        796    154380    155176    -      1887974   0.00e+00    1431    
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    7     7     57.915    469       95.736   9      4        464    1280313   1280780   +      1887974   3.71e-236   829     
ERR5396170.1000006   796    3      GCF_013394085.1   NZ_CP040910.1       99.623    8     8     42.839    341       99.120   0      456      796    1282477   1282817   +      1887974   6.91e-168   601     
ERR5396170.1000006   796    3      GCF_009663775.1   NZ_RDBR01000008.1   99.623    1     1     99.623    801       93.383   9      4        796    21391     22190     -      52610     0.00e+00    1278    
ERR5396170.1000006   796    3      GCF_003344625.1   NZ_QPKJ02000188.1   97.362    1     1     87.437    700       98.143   5      22       717    1         699       -      826       0.00e+00    1249    
ERR5396170.1000006   796    3      GCF_003344625.1   NZ_QPKJ02000423.1   97.362    2     2     27.889    222       99.550   0      575      796    1         222       +      510       3.47e-106   396     
ERR5396170.1000000   698    2      GCF_001457615.1   NZ_LN831024.1       92.264    1     1     92.264    656       96.341   13     53       696    4452083   4452737   +      6316979   0.00e+00    1169    
ERR5396170.1000000   698    2      GCF_000949385.2   NZ_JYKO02000001.1   91.977    1     1     91.977    654       78.135   13     55       696    5638788   5639440   -      5912440   2.68e-176   630     
ERR5396170.1000001   2505   3      GCF_000307025.1   NC_018584.1         67.066    1     1     67.066    1690      97.633   16     47       1726   1905511   1907194   -      2951805   0.00e+00    2985    
ERR5396170.1000001   2505   3      GCF_900187225.1   NZ_LT906436.1       65.070    1     1     65.070    1641      93.723   20     95       1724   1869503   1871134   -      2864663   0.00e+00    2626    
ERR5396170.1000001   2505   3      GCF_013394085.1   NZ_CP040910.1       30.858    1     1     30.858    780       97.692   9      1726     2498   183873    184650    +      1887974   0.00e+00    1384    
ERR5396170.1000001   2505   3      GCF_013394085.1   NZ_CP040910.1       30.858    2     2     5.030     127       87.402   1      2233     2358   1236170   1236296   +      1887974   1.73e-37    167     
ERR5396170.1000001   2505   3      GCF_013394085.1   NZ_CP040910.1       30.858    3     3     5.150     130       80.769   12     2233     2361   930381    930499    -      1887974   6.61e-43    185     
ERR5396170.1000001   2505   3      GCF_013394085.1   NZ_CP040910.1       30.858    4     4     3.713     93        93.548   0      2257     2349   1104581   1104673   -      1887974   5.09e-30    141

CIGAR string, aligned query and subject sequences can be outputted as extra columns via the flag -a/--all.

Extracting matched sequences:

# Extracting similar sequences for a query gene.

# search matches with query coverage >= 90%
lexicmap search -d demo.lmi/ bench/b.gene_E_faecalis_SecY.fasta -o results.tsv \
    --min-qcov-per-hsp 90

# extract matched sequences as FASTA format
lexicmap utils subseq -d demo.lmi -f results.tsv -o results.tsv.aligned.fasta

seqkit head -n 1 results.tsv.aligned.fasta | head -n 3
>NZ_KB944588.1:228637-229935:+ query=lcl|NZ_CP064374.1_cds_WP_002359350.1_906 sgenome=GCF_000392875.1 sseqid=NZ_KB944588.1 qcovGnm=100.000 cls=1 hsp=1 qcovHSP=100.000 alenHSP=1299 pident=100.000 gaps=0 qstart=1 qend=1299 sstart=228637 send=229935 sstr=+ slen=274762 evalue=0.00e+00 bitscore=2343
TTGTTCAAGCTATTAAAGAACGCCTTTAAAGTCAAAGACATTAGATCAAAAATCTTATTT
ACAGTTTTAATCTTGTTTGTATTTCGCCTAGGTGCGCACATTACTGTGCCCGGGGTGAAT

Export blast-style format:

# here, we only align <=200 bp queries and show one medium-similarity result.

$ seqkit seq -g -M 200 q.long-reads.fasta.gz \
    | lexicmap search -d demo.lmi/ -a \
    | csvtk filter2 -t -f '$pident >80 && $pident < 90' \
    | csvtk head -t -n 1 \
    | lexicmap utils 2blast --kv-file-genome ass2species.map

Query = GCF_003697165.2_r40
Length = 186

[Subject genome #1/2] = GCF_002950215.1 Shigella flexneri
Query coverage per genome = 93.548%

>NZ_CP026788.1 
Length = 4659463

 HSP cluster #1, HSP #1
 Score = 279 bits, Expect = 9.66e-75
 Query coverage per seq = 93.548%, Aligned length = 177, Identities = 88.701%, Gaps = 6
 Query range = 13-186, Subject range = 1124816-1124989, Strand = Plus/Plus

Query  13       CGGAAACTGAAACA-CCAGATTCTACGATGATTATGATGATTTA-TGCTTTCTTTACTAA  70
                |||||||||||||| |||||||||| | |||||||||||||||| |||||||||| ||||
Sbjct  1124816  CGGAAACTGAAACAACCAGATTCTATGTTGATTATGATGATTTAATGCTTTCTTTGCTAA  1124875

Query  71       AAAGTAAGCGGCCAAAAAAATGAT-AACACCTGTAATGAGTATCAGAAAAGACACGGTAA  129
                ||    |||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct  1124876  AA--GCAGCGGCCAAAAAAATGATTAACACCTGTAATGAGTATCAGAAAAGACACGGTAA  1124933

Query  130      GAAAACACTCTTTTGGATACCTAGAGTCTGATAAGCGATTATTCTCTCTATGTTACT  186
                 || |||||||||    |||||  |||||||||||||||||||||||| |||| |||
Sbjct  1124934  AAAGACACTCTTTGAAGTACCTGAAGTCTGATAAGCGATTATTCTCTCCATGT-ACT  1124989

Learn more: demo, tutorials, or usages.

Performance

See the paper.

Installation

LexicMap is implemented in Go programming language, executable binary files for most popular operating systems are freely available in release page.

Or install with conda or pixi:

conda install -c bioconda lexicmap

We also provide pre-release binaries, with new features and improvements.

Algorithm overview

LexicMap overview

Citation

Wei Shen, John A. Lees, Zamin Iqbal. (2024) LexicMap: efficient sequence alignment against millions of prokaryotic genomes. bioRxiv. https://doi.org/10.1101/2024.08.30.610459

Limitations

  • The queries need to be longer than 100 bp, though some shorter one can also be aligned.
  • LexicMap is slow for >1Mb queries, and the alignment might be fragmented.
  • LexicMap is slow for batch searching with more than hundreds of queries. However, there are some ways to improve the search speed of lexicmap search, such as keeping the top N genome matches via -n/--top-n-genomes or storing the index on solid state drives (SSDs).

Terminology differences

  • In the LexicMap source code and command line options, the term "mask" is used, following the terminology in the LexicHash paper.
  • In the LexicMap manuscript, however, we use "probe" as it is easier to understand. Because these masks, which consist of thousands of k-mers and capture k-mers from sequences through prefix matching, function similarly to DNA probes in molecular biology.

Support

Please open an issue to report bugs, propose new functions or ask for help.

License

MIT License

Related projects